Sesame, known as Sesamum indicum (L.), has 2n = 26 chromosomes and a small genome of 354 Mb. It belongs to Pedaliaceae Lindl family. Sesame seeds are infected by fungi that present a threat for using the seeds for different purposes, especially the fungi of Penicillium genus. Mycotoxins, secondary metabolites, present a hazard for seeds as they spoil their quality. Current work focuses on identifying fungal pathogens in sesame seeds (Sesamum indicum L.) of twelve genotypes: Biolsadovski, Zaltsadovski, Leader, Manzhursky ulucsheny, Kubanets 57, Donskoy belosemyanny, Liano, Natasha, Margo, Solnechny, Gusar, Serebrysty. Pathogen identification was performed using molecular methods. For this purpose, total DNA was extracted from seeds using 5% SDS extraction buffer. Intact seeds with no visually distinguished symptoms of diseases were sampled for diagnostics. DNA samples were tested using nested-PCR assay and primers specific for fungal pathogens. The sensibility and specificity of identification of pathogen of interest in nested-PCR are significantly enhanced due to a second PCR round with inner primers. Penicillium citrinum was identified using primers to β-tubulin (btub) gene. In the first PCR round the following primers were used: fr. CCTTGATGGCGATGGACAGT, rev. CAGCACCGGATTGACCGAAA in 35 cycles. In the second PCR round the following primers were used fr. CTACAACGGAACCTCCGATCTC, rev. AGCACCGGATTGACCGAAAA in 30 cycles. Annealing temperature in the first round was 610C, in the second - 600C. As a result, in eleven samples pathogens were identified. Only variety Lider was not infected with P. citrinum. Seed testing for pathogen presence and their associated mycotoxins, transmitted via seeds, is an important step for preventing diseases’ propagation and may lead to yield increase of the tested object and safe usage of sesame seeds in alimentation.