Articolul precedent |
Articolul urmator |
1120 6 |
Ultima descărcare din IBN: 2023-04-08 09:31 |
Căutarea după subiecte similare conform CZU |
577.21:582.284.51:633.853.74 (1) |
Материальные основы жизни. Биохимия. Молекулярная биология. Биофизика (667) |
Систематика растений (866) |
Эфиромасличные растения. Ароматические, пряные, масличные, красильные, дубильные, лекарственные растения (437) |
SM ISO690:2012 BELOUSOVA, Galina, MOGÎLDA, Anatolii. Molecular-genetic identification Alternaria spp. in sesame seeds. In: International Congress of Geneticists and Breeders from the Republic of Moldova, Ed. 11, 15-16 iunie 2021, Chişinău. Chișinău, Republica Moldova: Centrul Editorial-Poligrafic al Universităţii de Stat din Moldova, 2021, Ediția 11, p. 72. ISBN 978-9975-933-56-8. DOI: https://doi.org/10.53040/cga11.2021.051 |
EXPORT metadate: Google Scholar Crossref CERIF DataCite Dublin Core |
International Congress of Geneticists and Breeders from the Republic of Moldova Ediția 11, 2021 |
||||||
Congresul "International Congress of Geneticists and Breeders from the Republic of Moldova" 11, Chişinău, Moldova, 15-16 iunie 2021 | ||||||
|
||||||
DOI:https://doi.org/10.53040/cga11.2021.051 | ||||||
CZU: 577.21:582.284.51:633.853.74 | ||||||
Pag. 72-72 | ||||||
|
||||||
Descarcă PDF | ||||||
Rezumat | ||||||
Sesame (Sesamum indicum L.) belongs to the order Tubiflorae and Pedaliaceae family. The Sesamum genus comprises 37 species, of which Sesame indicum L. is the predominant cultivated species. Seed microflora leads to a decrease in yield. It is difficult to identify seed damage by pathogens. Fungal pathogens can be transmitted through seeds, either on the surface or inside the seed. Pathogenic infection of Alternaria spp. is the most destructive. The purpose of this work was to identify the infection of sesame seeds of ‘Zaltsadovski’, ‘Biolsadovski’ varieties with fungal pathogens Alternaria spp. using molecular methods. For the study, we used sesame seeds of the selection of the Institute of Genetics, Physiology and Plant Protection of the Republic of Moldova. To determine internal infection, the superficial infection was removed by treating the seeds with bleach. DNA was isolated from each seed (seed weight is about 4 mg) using 2% SDS buffer. DNA samples were tested in nested-PCR using primers specific to both fungal genera and species. Nested-PCR contributed to the specificity and accuracy of our study. Alternaria spp. was determined using primers for the RNA gene polymerase II second largest subunit. I round - for. (forward) GAACCAGAACCCCGATGCC, rev. (revers) GAACCAGAACCCCGATGCC, II round - for. GTGTCTGGGTTGGT GTCCAT, rev. ACGGCCAGCATCTGTGAAG. A signal of the Alternaria spp. pathogen was found in four of 12 samples of DNA from sesame seeds of the cultivar ‘Zaltsadovski’. The signal of the Alternaria spp. pathogen was identified in two of the 12 samples of DNA samples of sesame seeds of cultivar ‘Biolsadovski’. Samples showing the presence of pathogens were analyzed for Alternaria alternata and Alternaria solani. To identify A. alternata, primers from the conserved region of the glyceraldehede 3-phosphate dehydrogenase gene from the NCBI nucleotide bank were used. For the 1st round the primers were used: for. GGCCATCCAAGTTGCGAAAAC, rev. ACACCCATAACGAACATGGGG. For round II: for. TCTGTGGTCGCAGAATG CAG, rev. GGCGTCAGCAGAGGGAG. Only one of the 6 samples that showed the presence of pathogens Alternaria spp. for 2 cultivars was identified as A. alternata, pathogens of A. solani were not identified. ‘Zaltsadovski’ sesame seeds carried twice as many Alternaria spp |
||||||
|
Cerif XML Export
<?xml version='1.0' encoding='utf-8'?> <CERIF xmlns='urn:xmlns:org:eurocris:cerif-1.5-1' xsi:schemaLocation='urn:xmlns:org:eurocris:cerif-1.5-1 http://www.eurocris.org/Uploads/Web%20pages/CERIF-1.5/CERIF_1.5_1.xsd' xmlns:xsi='http://www.w3.org/2001/XMLSchema-instance' release='1.5' date='2012-10-07' sourceDatabase='Output Profile'> <cfResPubl> <cfResPublId>ibn-ResPubl-132827</cfResPublId> <cfResPublDate>2021</cfResPublDate> <cfVol>Ediția 11</cfVol> <cfStartPage>72</cfStartPage> <cfISBN>978-9975-933-56-8</cfISBN> <cfURI>https://ibn.idsi.md/ro/vizualizare_articol/132827</cfURI> <cfTitle cfLangCode='EN' cfTrans='o'>Molecular-genetic identification Alternaria spp. in sesame seeds</cfTitle> <cfAbstr cfLangCode='EN' cfTrans='o'><p>Sesame (Sesamum indicum L.) belongs to the order Tubiflorae and Pedaliaceae family. The Sesamum genus comprises 37 species, of which Sesame indicum L. is the predominant cultivated species. Seed microflora leads to a decrease in yield. It is difficult to identify seed damage by pathogens. Fungal pathogens can be transmitted through seeds, either on the surface or inside the seed. Pathogenic infection of Alternaria spp. is the most destructive. The purpose of this work was to identify the infection of sesame seeds of ‘Zaltsadovski’, ‘Biolsadovski’ varieties with fungal pathogens Alternaria spp. using molecular methods. For the study, we used sesame seeds of the selection of the Institute of Genetics, Physiology and Plant Protection of the Republic of Moldova. To determine internal infection, the superficial infection was removed by treating the seeds with bleach. DNA was isolated from each seed (seed weight is about 4 mg) using 2% SDS buffer. DNA samples were tested in nested-PCR using primers specific to both fungal genera and species. Nested-PCR contributed to the specificity and accuracy of our study. Alternaria spp. was determined using primers for the RNA gene polymerase II second largest subunit. I round - for. (forward) GAACCAGAACCCCGATGCC, rev. (revers) GAACCAGAACCCCGATGCC, II round - for. GTGTCTGGGTTGGT GTCCAT, rev. ACGGCCAGCATCTGTGAAG. A signal of the Alternaria spp. pathogen was found in four of 12 samples of DNA from sesame seeds of the cultivar ‘Zaltsadovski’. The signal of the Alternaria spp. pathogen was identified in two of the 12 samples of DNA samples of sesame seeds of cultivar ‘Biolsadovski’. Samples showing the presence of pathogens were analyzed for Alternaria alternata and Alternaria solani. To identify A. alternata, primers from the conserved region of the glyceraldehede 3-phosphate dehydrogenase gene from the NCBI nucleotide bank were used. For the 1st round the primers were used: for. GGCCATCCAAGTTGCGAAAAC, rev. ACACCCATAACGAACATGGGG. For round II: for. TCTGTGGTCGCAGAATG CAG, rev. GGCGTCAGCAGAGGGAG. Only one of the 6 samples that showed the presence of pathogens Alternaria spp. for 2 cultivars was identified as A. alternata, pathogens of A. solani were not identified. ‘Zaltsadovski’ sesame seeds carried twice as many Alternaria spp</p></cfAbstr> <cfResPubl_Class> <cfClassId>eda2d9e9-34c5-11e1-b86c-0800200c9a66</cfClassId> <cfClassSchemeId>759af938-34ae-11e1-b86c-0800200c9a66</cfClassSchemeId> <cfStartDate>2021T24:00:00</cfStartDate> </cfResPubl_Class> <cfResPubl_Class> <cfClassId>e601872f-4b7e-4d88-929f-7df027b226c9</cfClassId> <cfClassSchemeId>40e90e2f-446d-460a-98e5-5dce57550c48</cfClassSchemeId> <cfStartDate>2021T24:00:00</cfStartDate> </cfResPubl_Class> <cfPers_ResPubl> <cfPersId>ibn-person-1162</cfPersId> <cfClassId>49815870-1cfe-11e1-8bc2-0800200c9a66</cfClassId> <cfClassSchemeId>b7135ad0-1d00-11e1-8bc2-0800200c9a66</cfClassSchemeId> <cfStartDate>2021T24:00:00</cfStartDate> </cfPers_ResPubl> <cfPers_ResPubl> <cfPersId>ibn-person-46648</cfPersId> <cfClassId>49815870-1cfe-11e1-8bc2-0800200c9a66</cfClassId> <cfClassSchemeId>b7135ad0-1d00-11e1-8bc2-0800200c9a66</cfClassSchemeId> <cfStartDate>2021T24:00:00</cfStartDate> </cfPers_ResPubl> <cfFedId> <cfFedIdId>ibn-doi-132827</cfFedIdId> <cfFedId>10.53040/cga11.2021</cfFedId> <cfStartDate>2021T24:00:00</cfStartDate> <cfFedId_Class> <cfClassId>31d222b4-11e0-434b-b5ae-088119c51189</cfClassId> <cfClassSchemeId>bccb3266-689d-4740-a039-c96594b4d916</cfClassSchemeId> </cfFedId_Class> <cfFedId_Srv> <cfSrvId>5123451</cfSrvId> <cfClassId>eda2b2e2-34c5-11e1-b86c-0800200c9a66</cfClassId> <cfClassSchemeId>5a270628-f593-4ff4-a44a-95660c76e182</cfClassSchemeId> </cfFedId_Srv> </cfFedId> </cfResPubl> <cfPers> <cfPersId>ibn-Pers-1162</cfPersId> <cfPersName_Pers> <cfPersNameId>ibn-PersName-1162-3</cfPersNameId> <cfClassId>55f90543-d631-42eb-8d47-d8d9266cbb26</cfClassId> <cfClassSchemeId>7375609d-cfa6-45ce-a803-75de69abe21f</cfClassSchemeId> <cfStartDate>2021T24:00:00</cfStartDate> <cfFamilyNames>Белоусова</cfFamilyNames> <cfFirstNames>Галина</cfFirstNames> </cfPersName_Pers> </cfPers> <cfPers> <cfPersId>ibn-Pers-46648</cfPersId> <cfPersName_Pers> <cfPersNameId>ibn-PersName-46648-3</cfPersNameId> <cfClassId>55f90543-d631-42eb-8d47-d8d9266cbb26</cfClassId> <cfClassSchemeId>7375609d-cfa6-45ce-a803-75de69abe21f</cfClassSchemeId> <cfStartDate>2021T24:00:00</cfStartDate> <cfFamilyNames>Могылда</cfFamilyNames> <cfFirstNames>Анатолий</cfFirstNames> </cfPersName_Pers> </cfPers> <cfSrv> <cfSrvId>5123451</cfSrvId> <cfName cfLangCode='en' cfTrans='o'>CrossRef DOI prefix service</cfName> <cfDescr cfLangCode='en' cfTrans='o'>The service of issuing DOI prefixes to publishers</cfDescr> <cfKeyw cfLangCode='en' cfTrans='o'>persistent identifier; Digital Object Identifier</cfKeyw> </cfSrv> </CERIF>